Flask (za amnione) sterilan sa filterom, zapremine 25 ml (12.5 cm2)...

Datum objave: 14.07.2020. 13:43 / Izvor: Portal javnih nabavki/nabava BiH, 14.07.2020.

OBAVJEŠTENJE O DODJELI UGOVORA

1255-1-1-217-5-289/20


Broj obavještenja o nabavci 1255-1-1-217-3-156/20

ODJELJAK I: UGOVORNI ORGAN


I 1. Podaci o ugovornom organu

Naziv JZU UNIVERZITETSKI KLINIČKI CENTAR REPUBLIKE SRPSKE
IDB/JIB 4400928890000
Kontakt osoba Miljana Vračar
Adresa Dvanaest beba bb
Poštanski broj 78000 Banja Luka (sp)
Općina/Grad Banja Luka
Telefon (051) 342-806
Faks (051) 343-391
Elektronska pošta javne.nabavke@kc-bl.com
Internet adresa www.kc-bl.com

I 2. Vrsta ugovornog organa, nivo i glavna djelatnost

I 2.a. Vrsta

Pravno lice iz člana 4. stav (1) tačka b) ZJN

I 2.b. Nivo

Entitetski nivo,Republika Srpska

I 2.c. Djelatnost

Zdravstvo

I 3. Zajednička nabavka

Ne

I 4. Nabavka u ime drugih ugovornih organa?

Ne

ODJELJAK II: PREDMET UGOVORA


II 1. Vrsta ugovora

Robe, Kupovina

II 2. Podjela na lotove

Da

II 2.a. Dodjeljuje se ugovor za

Više lotova

II 2.a-1. Redni brojevi lotova za koje se dodjeljuje ugovor

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 25, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 38, 39, 40, 41, 45,
46, 53, 54, 55, 66, 75, 76, 79, 80, 81, 87, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 110, 111, 112, 113, 114, 115, 116, 117,
126, 154, 171, 174, 175, 176, 177, 178, 188, 193, 195, 196, 197

II 3. Da li je zaključen okvirni sporazum?

Ne

II 4. Opis

II 4.a. Naziv predmeta ugovora

Tender broj: 01-4259-1/20 radi nabavke reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku
dijagnostiku

II 4.b. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

II 4.c. Jedinstveni rječnik javne nabavke (JRJN)

  Glavni rječnik
Kod Opis
Glavni predmet 33000000-0 Medicinska oprema, lijekovi i proizvodi za ličnu njegu
Dodatni predmet(i) 33140000-3 Medicinski potrošni materijal


II 5. Podaci o Sporazumu o javnoj nabavci

II 5.a. Da li je ugovor obuhaćen Sporazumom o javnoj nabavci (GPA)?

Ne

II 8. Da li je dozvoljena alternativna ponuda?

Ne

ODJELJAK III: POSTUPAK


III 1. Vrsta postupka

Otvoreni postupak

III 2. Kriterij za dodjelu ugovora

Ekonomski najpovoljnija ponuda

III 4. Da li je korištena e-aukcija?

Ne

III 5. Da li je objavljeno prethodno informacijsko obavještenje?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

1


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Advia 1800

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

1198385,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 PROFY D.O.O. 4403529450003 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

1198381,36

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

1198381,36

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

1198381,36

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

2


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Advia 2120

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

216522,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 PROFY D.O.O. 4403529450003 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

216514,24

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

216514,24

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

216514,24

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

3


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Centaur XP

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

2617795,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 PROFY D.O.O. 4403529450003 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

2602128,04

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

2602128,04

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

2602128,04

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

4


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Attelica 1500

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

311522,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 PROFY D.O.O. 4403529450003 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

311518,72

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

311518,72

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

311518,72

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

5


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Siemens RP 500

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

986539,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 PROFY D.O.O. 4403529450003 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

986534,40

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

986534,40

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

986534,40

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

6


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Beckman Coulter DxC700

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

1025548,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 MAKLER RS 4404036710002 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

1025082,23

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

8.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

1025082,23

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

1025082,23

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

7


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Cobas

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

5561026,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 FARMAVITA D.O.O. 4200075750009 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

5552738,80

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

6.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

5552738,80

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

5552738,80

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

8


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Cobas e411

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

75975,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 FARMAVITA D.O.O. 4200075750009 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

75971,04

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

6.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

75971,04

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

75971,04

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

9


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat cobas Z480

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

688163,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 FARMAVITA D.O.O. 4200075750009 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

688160,72

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

6.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

688160,72

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

688160,72

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

10


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Biosen C

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

196821,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 BROMA BEL D.O.O. BANJA LUKA 4400839360005 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

200765,12

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

200765,12

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

200765,12

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

11


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat RAL Stainer

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

32112,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 BROMA BEL D.O.O. BANJA LUKA 4400839360005 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

32108,12

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

32108,12

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

32108,12

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

12


I Opis

I 1. Naziv predmeta ugovora

Reagensi i potrošni materijal za hematološki brojač Sysmex XN1000

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

959915,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 BROMA BEL D.O.O. BANJA LUKA 4400839360005 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

974435,20

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

974435,20

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

974435,20

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

13


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat HPLC

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

154189,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

154188,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

154188,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

154188,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

14


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Alegria

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

591086,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 BROMA BEL D.O.O. BANJA LUKA 4400839360005 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

589000,12

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

589000,12

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

589000,12

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

15


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat ABL 825

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

759847,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

759838,76

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

759838,76

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

759838,76

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

16


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Sebia

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

43018,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 PROFY D.O.O. 4403529450003 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

43008,84

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

43008,84

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

43008,84

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

17


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat BCS

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

1869573,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 PROFY D.O.O. 4403529450003 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

1869542,80

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

1869542,80

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

1869542,80

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

18


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Phadia 100

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

1044377,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ĐAKOVIĆ DOO 4403688920002 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

1044356,12

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

1044356,12

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

1044356,12

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

19


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat FACS Canto II

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

733505,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

733108,08

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

733108,08

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

733108,08

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

20


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat 2020 Multi-Sample Micro Osmometer

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

78462,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 DOO EUROLAB 4400375860000 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

56712,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

8.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

56712,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

56712,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

21


I Opis

I 1. Naziv predmeta ugovora

Reagensi i materijal za aparat Alinity ci

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

6000000,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

5634246,77

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

5634246,77

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

5634246,77

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

25


I Opis

I 1. Naziv predmeta ugovora

FLASK(za amnione) sterilan sa filterom, zapremine 25 ml (12.5 cm²) (da su dimenzije donje površine flaska na kojoj rastu
ćelijske kolonije 35x36 mm, ne računajući kosi dio dna flaska, da je površina za rast strogo optički ravna, da flask ima klinast
vrat, da je testiran na curenje tečnosti), dostaviti uzorak na uvid


I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

120787,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača


Jedan ponuđač

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

107360,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

107360,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

107360,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

26


I Opis

I 1. Naziv predmeta ugovora

FLASK(za amnione) sterilan bez filtera, zapremine 25 ml (12.5 cm²) (da su dimenzije donje površine flaska na kojoj rastu
ćelijske kolonije 35x36 mm, ne računajući kosi dio dna flaska, da je površina za rast strogo optički ravna, da flask ima klinast
vrat, da je testiran na curenje tečnosti), dostaviti uzorak na uvid

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

12000,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača


Jedan ponuđač

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

12000,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

12000,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

12000,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

27


I Opis

I 1. Naziv predmeta ugovora

KOMPLETAN TECNI MEDIJUM ZA KULTIVACIJU AMNIOCITA 1x konc. á 100ml ( sadrži medijum, L glutamin, fetalni teleći
serum, penicilin, gentamicin,streptomicin ,antimikotik), jedan proizvođač, (zamrznut, -20°C ) dostaviti uzorak na uvid

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

45770,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

45760,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

45760,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

45760,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

28


I Opis

I 1. Naziv predmeta ugovora

KOMPLETAN TEČNI MEDIJUM ZA KULTIVACIJU AMNIOCITA 1x konc. à 100 ml(sadrži medijum, L glutamin, fetalni teleći
serum, penicilin, gentamicin, streptomicin, antimikotik) (zamrznut, -20°C ), drugi proizvođač, dostaviti uzorak na uvid

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

39650,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

42000,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

42000,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

42000,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

29


I Opis

I 1. Naziv predmeta ugovora

KOMPLETAN TEČNI MEDIJUM ZA KULTIVACIJU LIMFOCITA PERIFERNE KRVI à 100 ml, spreman za upotrebu.Sadrži fetalni
goveđi serum, gentamicin , L-glutamin i fitohemaglutinin. Čuva se na temperaturi od -5 do -20° C, dostaviti uzorak na uvid

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

12821,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

12820,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

12820,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

12820,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

30


I Opis

I 1. Naziv predmeta ugovora

Kompletan medijum za kulturu ćelija kostne srži à 100 ml, spreman za upotrebu.Sadrži serum, antibiotike i L-glutamin. Čuva
se na temperaturi od -18 do -22°C. Dostaviti uzorak na uvid

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

15864,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

16640,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

16640,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

16640,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

32


I Opis

I 1. Naziv predmeta ugovora

RPMI 1640 tečni medijum 1x konc. à 500 ml (+4˚C )

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

214,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

720,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

720,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

720,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

33


I Opis

I 1. Naziv predmeta ugovora

Kit za kultivaciju periferne krvi - epruvete za kulturu sa kompletnim medijumom, spremne za upotrebu, (zamrznut na-20°C)

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

684,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

3940,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

3940,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

3940,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

34


I Opis

I 1. Naziv predmeta ugovora

RPMI 1640 tečni medijum 1x konc. à 100 ml (bez folne kiseline,modifikovan za fragilni X hromozom +4˚C )

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

257,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

400,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

400,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

400,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

35


I Opis

I 1. Naziv predmeta ugovora

FETALNI TELEĆI SERUM á 500 ml odobren od EU, inaktivisan toplotom (zamrznut, -20°C)

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

2171,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

2170,88

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

2170,88

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

2170,88

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

36


I Opis

I 1. Naziv predmeta ugovora

FITOHEMAGLUTININ á 10 ml ( tečni, zamrznuti rastvor, -20°C ili liofilizirani prah ) dostaviti uzorak na uvid

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

14642,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

14640,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

14640,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

14640,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

38


I Opis

I 1. Naziv predmeta ugovora

GENTAMICIN reagens rastvor (10 mg/ml) ā 10 ml (tečni, zamrznuti 10x konc, -20°C)

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

223,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

232,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

232,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

232,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

39


I Opis

I 1. Naziv predmeta ugovora

ANTIBIOTIK/ ANTIMIKOTIK rastvor 100x konc. á 100ml ( tečni zamrznuti, -20ºC, sadrži penicilin10.000 IU/ml, streptomicin
10.000 µg/ml, amfotericin B 250 µg/ml )

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

838,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

838,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

838,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

838,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

40


I Opis

I 1. Naziv predmeta ugovora

PENICILIN/ STREPTOMICIN rastvor 100x konc. ( tečni, zamrznuti, -20ºC, sadrži penicilin 10.000 IU/ml, streptomicin 10.000
µg/ml) á100ml

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

171,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

160,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

160,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

160,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

41


I Opis

I 1. Naziv predmeta ugovora

TRIPSIN 0,05% sa EDTA 0,02% u PBS á100 ml ( bez Ca i Mg jona i bez fenol crvenog /Phenol red/, tečni zamrznuti, -20ºC),
dostaviti uzorak na uvid

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

16129,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

15000,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

15000,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

15000,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

45


I Opis

I 1. Naziv predmeta ugovora

TRIPSIN - Tripsin u prahu, porcine. Namijenjen za proteolitičko, enzimsko djelovanje, za GTG trake i tripsinizaciju kultura
amniona à 100 gr

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

1804,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

4429,80

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

4429,80

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

4429,80

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

46


I Opis

I 1. Naziv predmeta ugovora

GURR pufer tablete za puferisanje fiziološkog rastvora na pH 6.8 à 50 tableta

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

1428,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

1600,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

1600,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

1600,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

53


I Opis

I 1. Naziv predmeta ugovora

IGLE promjera 0.9 x 40 mm, dostaviti uzorak na uvid

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

368,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 CO.MEDPROM D.O.O. 4400878930005 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

438,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

6.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

438,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

438,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

54


I Opis

I 1. Naziv predmeta ugovora

IGLE promjera 1.2 x 40 mm, dostaviti uzorak na uvid

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

2992,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 CO.MEDPROM D.O.O. 4400878930005 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

2988,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

6.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

2988,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

2988,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

55


I Opis

I 1. Naziv predmeta ugovora

FILTERI (SYRING FILTER) za filtraciju vodenih rastvora, zapremine do 100 ml, dijametar pora 0.2 µm, sterilni, pojedinačno
upakovani (ā 50 kom)

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

736,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 MIKRO+POLO D.O.O. 4201572320006 Ilidža Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

480,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

480,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

480,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

66


I Opis

I 1. Naziv predmeta ugovora

Acidum citricum p.a. C6H8O7

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

73,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 SEMIKEM D.O.O. SARAJEVO 4200003250001 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

68,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

68,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

68,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

75


I Opis

I 1. Naziv predmeta ugovora

INDIKATOR PAPIR (pH 5.2 - 7.4); dostaviti uzorak

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

325,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 SEMIKEM D.O.O. SARAJEVO 4200003250001 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

380,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

380,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

380,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

76


I Opis

I 1. Naziv predmeta ugovora

FLASKOVI za in situ kultivaciju amniona , površine za rast 9 cm², sa predmetnom pločicom koja se odvaja, dimenzija 25 x 75
mm,

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

5129,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 BROMA BEL D.O.O. BANJA LUKA 4400839360005 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

520,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

520,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

520,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

79


I Opis

I 1. Naziv predmeta ugovora

Qubit assay tubes, 500/pak

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

1932,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

2400,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

2400,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

2400,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

80


I Opis

I 1. Naziv predmeta ugovora

Esej za određivanje koncentracije RNK visoke sentitivnosti, 100 analiza, Specifičan za RNK i kvantificira RNKa u opsegu od
250 pg/µL i 100 ng/µL Kit ne smije kvantificirati DNK, proteine ili slobodne nukleotide Kit se sastoji od dilucionog pufera i već
razrijeđenog RNK standarda Mora biti kompatibilan sa instrumentom Qubit.

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

1915,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača


Jedan ponuđač

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

2800,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

2800,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

2800,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

81


I Opis

I 1. Naziv predmeta ugovora

Esej za određivanje koncentracije DNK visoke sentitivnosti, 100 analiza.Specifičan za dvolančanu DNK i kvantificira DNK u
opsegu od 10 pg/µL and 100 ng/µL. Kit ne smije kvantificirati RNK i mora biti otporan na onečišćenja kao što su soli,
sporadični nukleotidi, deterdženti, proteini i slično. Kit se sastoji od dilucionog pufera i već razrijeđenog DNK standarda.
Mora biti kompatibilan sa instrumentom Qubit

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

3830,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača


Jedan ponuđač

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

5120,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

5120,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

5120,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

87


I Opis

I 1. Naziv predmeta ugovora

Kit za izolaciju DNA iz krvi i tkiva, mogućnost rada PCR, real-time PCR, genotipizacija, silica tehnologija, sa prinosom 6 µg/30
µg

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

7522,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 MIKRO+POLO D.O.O. 4201572320006 Ilidža Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

7520,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

7520,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

7520,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

91


I Opis

I 1. Naziv predmeta ugovora

Master smješa za genotipizaciju, 10ml, Pasivna boja: ROX; Čistoća:ultra čista; koncentracija:2x; Mora biti validirana sa
esejom za detekciju polimorfizma jednog nukleotida, mora sadržavati polimerazu koja se aktivira na visokim
temperaturama, dNTP strukture bez dUTP i pasivnu referencu

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

5154,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača


Jedan ponuđač

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

10800,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

10800,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

10800,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

92


I Opis

I 1. Naziv predmeta ugovora

Kit za detekciju V617F mutacije u JAK2 genu, 75 reakcija,za uzorke:ćelijske linije, FFPE uzorci, krv i svježe zaleđeni
uzorci,detektuje 0,1% mutirane DNK u podlozi od 10 000 kopija normalne genomske DNK-a. Kit mora sadrzavati specijalni
blokator koji sprečava amplifikaciju nemutiranih alela, kao i alel specificne prajmere koji detekuju mutatne alele, lokus
specifične prajmere i probe; Uz kit treba doci softwer namijenjen za interpretaciju podataka

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

12231,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača


Jedan ponuđač

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

17400,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

17400,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

17400,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

93


I Opis

I 1. Naziv predmeta ugovora

Esej sa referentnim genom za JAK 2 V617F mutaciju , 75 analiza. Esej amlificira nemutirani region gena

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

8069,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

11520,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

11520,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

11520,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

94


I Opis

I 1. Naziv predmeta ugovora

IPC kontrola za detekciju PCR inhibicije

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

4240,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

6240,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

6240,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

6240,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

95


I Opis

I 1. Naziv predmeta ugovora

POKWEED MITOGEN - Lektin iz Phytolacca americana (pokeweed) , liofilizirani prah, za mitogenu stimulaciju limfocita,
mitogena aktivnost ≤0,3μg/ml, à 5mg , čuvanje na temp.2-8°C

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

684,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 MIKRO+POLO D.O.O. 4201572320006 Ilidža Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

798,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

798,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

798,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

96


I Opis

I 1. Naziv predmeta ugovora

Phorbol-12-myristate-13 acetat – à 1mg, za mitogenu stimulaciju limfocita, čuvanje na temp.-20°C

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

821,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 MIKRO+POLO D.O.O. 4201572320006 Ilidža Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

956,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

956,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

956,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

97


I Opis

I 1. Naziv predmeta ugovora

Prajmeri, 25 nmol: Primer forward 5′-AACATTAACTTGGTGTATCGATTGGT-3′ . Primer reverse 5′-AGCAGGCCCAGGACAAGT-3′

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

86,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

120,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

120,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

120,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

98


I Opis

I 1. Naziv predmeta ugovora

Proba, koncentracija 6000nmol, obiljezene VIC bojom, i prigušivačem MGB NFQ. I TE puferom.Čistoća: HPLC.
TTGCCATATATATATATATAAGTAGGA

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

3009,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

4280,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

4280,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

4280,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

99


I Opis

I 1. Naziv predmeta ugovora

Proba, koncentracija 6000 nmol, obiljezene VIC bojom, i prigušivačem MGB NFQ. I TE puferom. Čistoća:
HPLC.TGCCATATATATATATATATAAGTAGGA

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

3009,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

3840,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

3840,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

3840,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

100


I Opis

I 1. Naziv predmeta ugovora

Master smješa, 1ml.Namjenjena za genotipizaciju i CNV analize.Sadrži internu pasivnu boju ROX i pogodna je za kliničke
uzorke koji sadrže inhibitrore.Polimeraza treba da se aktivira na temperaturi od 95 stepeni.

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

1795,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

2720,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

2720,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

2720,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

101


I Opis

I 1. Naziv predmeta ugovora

Kit za osjetljivu i pouzdanu detek. i kvantif.niskih razinaBCR-ABL p210 b2a2 ili b3a2 transkrip. u odnosu na ekspresiju
ABLkontrolnog gena pomoćuRT-PCR reakcije,kao i konverziju rez.u međ.skalu i MMR izvještaj.Kita za 24uzorka sadrži:Visoko
pozitivna RNA kontr.,IS-MMR kalibrator,Mbcr i ABL Single Plasmid Standards(5 dilucija za Mbcr i 4 dilucije za ABL),Primers i
Probe Mix ABL,Primers i Probe Mix BCR-ABL Mbcr Fusion Gene.Setovi primera i proba diz.u skladu sa EAC.Osjetljivost ima
limit det.(LOD)0,0069

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

40428,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA



IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 MIKRO+POLO D.O.O. 4201572320006 Ilidža Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

40416,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

40416,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

40416,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

110


I Opis

I 1. Naziv predmeta ugovora

PINCETA , nerđajući čelik, zaobljeni vrh sa nazubljenim unutrašnjim dijelom, dužina 130 mm

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

171,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 SEMIKEM D.O.O. SARAJEVO 4200003250001 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

170,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

170,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

170,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

111


I Opis

I 1. Naziv predmeta ugovora

PINCETA ,nerđajući čelik, oštri vrh sa nazubljenim unutrašnjim dijelom, dužina 110 mm

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

171,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 SEMIKEM D.O.O. SARAJEVO 4200003250001 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

200,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

200,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

200,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

112


I Opis

I 1. Naziv predmeta ugovora

PINCETA , nerđajući čelik sa nazubljenim unutrašnjim dijelom, zakrivljeni vrh, dužina 150 mm

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

171,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 SEMIKEM D.O.O. SARAJEVO 4200003250001 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

200,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

200,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

200,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

113


I Opis

I 1. Naziv predmeta ugovora

MAKAZE, metalne, sa oštrim vrhom, dužina 180 mm

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

35,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 SEMIKEM D.O.O. SARAJEVO 4200003250001 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

36,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

36,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

36,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

114


I Opis

I 1. Naziv predmeta ugovora

PLAMENIK, alkoholni, stakleni, zapremine 100 ml

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

171,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 SEMIKEM D.O.O. SARAJEVO 4200003250001 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

200,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

200,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

200,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

115


I Opis

I 1. Naziv predmeta ugovora

Rukavice bez pudera, nitrilne. Pakovanje 100 kom, veličina 6 ili S

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

257,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 SEMIKEM D.O.O. SARAJEVO 4200003250001 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

240,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

240,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

240,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

116


I Opis

I 1. Naziv predmeta ugovora

Rukavice bez pudera, nitrilne. Pakovanje 100 kom, veličina 7 ili M

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

257,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 SEMIKEM D.O.O. SARAJEVO 4200003250001 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

240,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

240,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

240,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

117


I Opis

I 1. Naziv predmeta ugovora

Apsolutni alkohol, à 1000 ml

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

513,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 MIKRO+POLO D.O.O. 4201572320006 Ilidža Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

536,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

536,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

536,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

126


I Opis

I 1. Naziv predmeta ugovora

Stalak za epruvete sa 96 mjesta

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

3419,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 DOO EUROLAB 4400375860000 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

4728,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

8.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

4728,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

4728,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

154


I Opis

I 1. Naziv predmeta ugovora

TIKVICA, staklena, graduisana plavo ili bijelo, kalibrisana, sa odgovarajućim čepom, sa ravnim dnom, kratko grlo, zapremine
1000 ml

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

274,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 DOO EUROLAB 4400375860000 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

68,80

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

8.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

68,80

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

68,80

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

171


I Opis

I 1. Naziv predmeta ugovora

Lakmus papir (pH indikator 7-8 pH)

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

428,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 SEMIKEM D.O.O. SARAJEVO 4200003250001 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

470,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

470,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

470,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

174


I Opis

I 1. Naziv predmeta ugovora

Heterophilic Blocking Tube - HBT ( epruvete za eliminaciju interferencije heterofilnih antitijela za imunohemijske testove)

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

2052,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

11040,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

11040,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

11040,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

175


I Opis

I 1. Naziv predmeta ugovora

Angiotenzin konvertujući enzim

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

25607,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

25600,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

25600,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

25600,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

176


I Opis

I 1. Naziv predmeta ugovora

Polietilen glikol PEG 6000 a 1000g

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

1026,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 SEMIKEM D.O.O. SARAJEVO 4200003250001 Vogošća Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

1200,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

1.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

1200,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

1200,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

177


I Opis

I 1. Naziv predmeta ugovora

Sterilna staklena epruveta za vađenje krvi sa antikoagulansom, ACD Sol A 16x100mm žuti čep

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

8069,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

9280,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

9280,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

9280,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

178


I Opis

I 1. Naziv predmeta ugovora

Sterilne vakum epruvete bez aditiva 16x100mm

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

2052,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 BROMA BEL D.O.O. BANJA LUKA 4400839360005 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

2560,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

2560,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

2560,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

188


I Opis

I 1. Naziv predmeta ugovora

Inhibin B ELISA

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

33334,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

33327,36

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

33327,36

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

33327,36

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

193


I Opis

I 1. Naziv predmeta ugovora

C1 inhibitor ELISA

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

14402,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 ,,MEDICOM,, D.O.O. 4400441670004 Bijeljina Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

14400,00

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

10.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

14400,00

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

14400,00

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

195


I Opis

I 1. Naziv predmeta ugovora

Reagens za određivanje žučnih kiselina u serumu

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

8411,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 BROMA BEL D.O.O. BANJA LUKA 4400839360005 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

8252,40

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

8252,40

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

8252,40

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

196


I Opis

I 1. Naziv predmeta ugovora

Kalibrator za žučne kiseline

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

240,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 BROMA BEL D.O.O. BANJA LUKA 4400839360005 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

226,48

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

226,48

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

226,48

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne


ANEKS D


Broj lota za koji se dodjeljuje ugovor

197


I Opis

I 1. Naziv predmeta ugovora

Kontrola za žučne kiseline

I 2. Kratak opis predmeta ugovora

Nabavka reagenasa i potrošnog materijala za potrebe Zavoda za kliničku laboratorijsku dijagnostiku

I 3. Jedinstveni rječnik javne nabavke (JRJN)

 

 

 

 

  Glavni rječnik
Kod Opis
Glavni predmet 33140000-3 Medicinski potrošni materijal


II Ukupna količina ili obim ugovora

Precizirano tenderskom dokumentacijom

II 1. Procijenjena ukupna vrijednost ugovora bez PDV-a u KM

206,00

II 2. Trajanje ugovora ili rok izvršenja

Do ispunjenja obaveza iz predmeta ugovora

II 3. Mjesto isporuke roba ili izvršenja usluga ili izvođenja radova

FCO Klinička apoteka, Univerzitetskog kliničkog centra Republike Srpske, istovareno.

III Potkriteriji

R.Br. Naziv Učešće
1 Cijena 70,00 %
2 Rok isporuke 30,00 %

IV ODJELJAK IV: DODJELA UGOVORA


IV 1. Podaci o najuspješnijem ponuđaču/grupi ponuđača

Jedan ponuđač

 

 

 

 

R.Br. Naziv IDB/JIB Općina/Grad Država
1 BROMA BEL D.O.O. BANJA LUKA 4400839360005 Banja Luka Bosna i Hercegovina


IV 2. Informacije o dodjeli ugovora

IV 2.a. Konačna ukupna vrijednost ugovora/okvirnog sporazuma bez PDV-a u KM

197,60

IV 2.c. Datum zaključenja ugovora/okvirnog sporazuma

2.7.2020.

IV 2.d. Broj primljenih ponuda

1

IV 2.e. Broj prihvatljivih ponuda

1

IV 2.f. Vrijednost najniže prihvatljive ponude bez PDV-a u KM

197,60

IV 2.g. Vrijednost najviše prihvatljive ponude bez PDV-a u KM

197,60

IV 2.h. Primjena preferencijalnog tretmana

Ne

IV 4. Informacije o podugovaranjima

IV 4.a. Ugovor će se vjerovatno podugovarati?

Ne

ODJELJAK V: DODATNE INFORMACIJE


V 1. Da li su korišteni pravni lijekovi u postupku za dodjelu ovog ugovora?

Ne

V 2. Da li je nabavka finansirana iz sredstava EU?

Ne

 

 

 

PRIKAŽI VIŠE TEKSTA

PREUZMI DOKUMENT:
1255-1-1-217-5-289/20
PODIJELI: